BAC Mapping
Query Menu
Chr11 marker
BCM BAC ends
TIGR BAC ends
Human marker
MIT marker allele sizes
in mouse strains C57BL/6J and 129Sv/Ev/Brd
-- Designing Overgo and PCR primers Tool
| Home | Project | Genomics | Publications | Links |
| ACTGACTGACTGACTGACTGACTGACTGACTGACTGACTG |
Overgo program is for designing overgo probes and/or PCR primers used in genomic library screening.This program is an improved version of the one described in the Genomics 54, 387-397(1998). It has been used to design thousands of overgo probes from mouse SSLP sequences. Our experimental results indicate that failtures caused by primer design are undetectable using this system. This program can be used to design PCR primers or overgos to all of the species subject to genomic approaches, however, we should stress though that this has only been functionally tested in mice. Please be aware that this program is copyright protected by Baylor College of Medicine in 1998 and should not be duplicated, passed onto third parties, or reversed engineered.
<<< Back
URL: http://www.mouse-genome.bcm.tmc.edu Data provided in this web site is only for scientific research and educational purposes. Questions and feedbacks: Webmaster